Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104576
Name   oriT1_STEFF_14|unnamed2 in_silico
Organism   Klebsiella pneumoniae strain STEFF_14
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055188 (19733..19831 [+], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT1_STEFF_14|unnamed2
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5015 GenBank   NZ_CP055188
Plasmid name   STEFF_14|unnamed2 Incompatibility group   IncFIA
Plasmid size   58759 bp Coordinate of oriT [Strand]   19733..19831 [+]; 58459..58552 [+]
Host baterium   Klebsiella pneumoniae strain STEFF_14

Cargo genes


Drug resistance gene   aph(3')-Ia, aac(3)-IId, blaTEM-1B, aac(6')-Ib-cr, ARR-3, dfrA27, aadA16, qacE, sul1, qnrB52
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -