Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104573 |
Name | oriT_SWHEFF_62|unnamed2 |
Organism | Klebsiella pneumoniae strain SWHEFF_62 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP055035 (1374..1433 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_SWHEFF_62|unnamed2
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5012 | GenBank | NZ_CP055035 |
Plasmid name | SWHEFF_62|unnamed2 | Incompatibility group | Col |
Plasmid size | 1552 bp | Coordinate of oriT [Strand] | 1374..1433 [+] |
Host baterium | Klebsiella pneumoniae strain SWHEFF_62 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |