Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104562
Name   oriT_SWHIN_110|unnamed2 in_silico
Organism   Shigella flexneri strain SWHIN_110
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055094 (6468..6527 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_SWHIN_110|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5001 GenBank   NZ_CP055094
Plasmid name   SWHIN_110|unnamed2 Incompatibility group   Col440I
Plasmid size   12602 bp Coordinate of oriT [Strand]   6468..6527 [-]
Host baterium   Shigella flexneri strain SWHIN_110

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -