Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104561 |
| Name | oriT_SWHIN_110|unnamed1  |
| Organism | Shigella flexneri strain SWHIN_110 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055093 (81229..81327 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_SWHIN_110|unnamed1
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5000 | GenBank | NZ_CP055093 |
| Plasmid name | SWHIN_110|unnamed1 | Incompatibility group | IncY |
| Plasmid size | 93448 bp | Coordinate of oriT [Strand] | 81229..81327 [+] |
| Host baterium | Shigella flexneri strain SWHIN_110 |
Cargo genes
| Drug resistance gene | aadA2, sul3, mph(A), sul1, qacE, dfrA12, aac(3)-IId, blaTEM-1B, catA2, sul2, aph(3'')-Ib, aph(6)-Id, aph(3')-Ia, ant(3'')-Ia, tet(A) |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |