Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104550
Name   oriT_STLE4|unnamed1 in_silico
Organism   Shigella flexneri strain STLE4
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058832 (33639..33737 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_STLE4|unnamed1
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4989 GenBank   NZ_CP058832
Plasmid name   STLE4|unnamed1 Incompatibility group   IncFIB
Plasmid size   86483 bp Coordinate of oriT [Strand]   33639..33737 [-]
Host baterium   Shigella flexneri strain STLE4

Cargo genes


Drug resistance gene   aadA2, dfrA12, aac(3)-IId, oqxA, oqxB, tet(A), aph(6)-Id, aph(3'')-Ib, sul2, blaTEM-1B, floR
Virulence gene   -
Metal resistance gene   silE, silS, silR, silC, silF, silB, silA, silP
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -