Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104550 |
| Name | oriT_STLE4|unnamed1  |
| Organism | Shigella flexneri strain STLE4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058832 (33639..33737 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_STLE4|unnamed1
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4989 | GenBank | NZ_CP058832 |
| Plasmid name | STLE4|unnamed1 | Incompatibility group | IncFIB |
| Plasmid size | 86483 bp | Coordinate of oriT [Strand] | 33639..33737 [-] |
| Host baterium | Shigella flexneri strain STLE4 |
Cargo genes
| Drug resistance gene | aadA2, dfrA12, aac(3)-IId, oqxA, oqxB, tet(A), aph(6)-Id, aph(3'')-Ib, sul2, blaTEM-1B, floR |
| Virulence gene | - |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |