Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104548 |
| Name | oriT_STLIN_6|unnamed5  |
| Organism | Shigella flexneri strain STLIN_6 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058795 (1071..1157 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_STLIN_6|unnamed5
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4987 | GenBank | NZ_CP058795 |
| Plasmid name | STLIN_6|unnamed5 | Incompatibility group | Col |
| Plasmid size | 1553 bp | Coordinate of oriT [Strand] | 1071..1157 [+] |
| Host baterium | Shigella flexneri strain STLIN_6 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |