Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104545
Name   oriT_STLEFF_35|unnamed2 in_silico
Organism   Shigella flexneri strain STLEFF_35
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058848 (46020..46371 [+], 352 nt)
oriT length   352 nt
IRs (inverted repeats)      192..198, 206..212  (TATAAAA..TTTTATA)
 197..202, 204..209  (AAAACA..TGTTTT)
 104..110, 118..124  (TTTAAAT..ATTTAAA)
 106..111, 113..118  (TAAATC..GATTTA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 352 nt

>oriT_STLEFF_35|unnamed2
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGATTTTAATATCATATGCTTATATTCATGAATTTATATTGTTTAAATCAGATTTATTTAAAACAGCGGTGTAGGCGCGGCTATGGCACCGTGTCTGCACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTGTTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACTGCTAGGGGCGCTGCTAGCGGCGCGTTCCTGTTTCCATTGTGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTTAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4984 GenBank   NZ_CP058848
Plasmid name   STLEFF_35|unnamed2 Incompatibility group   -
Plasmid size   54419 bp Coordinate of oriT [Strand]   46020..46371 [+]
Host baterium   Shigella flexneri strain STLEFF_35

Cargo genes


Drug resistance gene   aph(3'')-Ib, aph(6)-Id, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -