Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104538
Name   oriT_STLE3|unnamed1 in_silico
Organism   Shigella flexneri strain STLE3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058829 (107895..108179 [-], 285 nt)
oriT length   285 nt
IRs (inverted repeats)      184..189, 191..196  (AAAAGT..ACTTTT)
Location of nic site      109..110
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 285 nt

>oriT_STLE3|unnamed1
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4977 GenBank   NZ_CP058829
Plasmid name   STLE3|unnamed1 Incompatibility group   IncFIB
Plasmid size   169932 bp Coordinate of oriT [Strand]   107895..108179 [-]
Host baterium   Shigella flexneri strain STLE3

Cargo genes


Drug resistance gene   blaTEM-1A, tet(A), dfrA12, aadA2, cmlA1, ant(3'')-Ia, sul3
Virulence gene   -
Metal resistance gene   arsR, arsD, arsA, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -