Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104536 |
| Name | oriT_STLIN_17|unnamed1  |
| Organism | Shigella flexneri strain STLIN_17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058781 (2912..3005 [+], 94 nt) |
| oriT length | 94 nt |
| IRs (inverted repeats) | 72..77, 84..89 (AAAAAA..TTTTTT) 72..77, 83..88 (AAAAAA..TTTTTT) 26..33, 36..43 (AGCGTGAT..ATCACGCT) 12..18, 30..36 (TAAATCA..TGATTTA) |
| Location of nic site | 54..55 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 94 nt
>oriT_STLIN_17|unnamed1
TTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTAACGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTAACGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4975 | GenBank | NZ_CP058781 |
| Plasmid name | STLIN_17|unnamed1 | Incompatibility group | IncFIB |
| Plasmid size | 99490 bp | Coordinate of oriT [Strand] | 2912..3005 [+] |
| Host baterium | Shigella flexneri strain STLIN_17 |
Cargo genes
| Drug resistance gene | oqxB, oqxA, aph(3')-Ia, floR, tet(A), blaTEM-1A |
| Virulence gene | - |
| Metal resistance gene | arsH, merR, merT, merP, merA, merD, merE, silP, silA, silB, silF, silC, silR, silS, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |