Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104516
Name   oriT_STEFF_24|unnamed2 in_silico
Organism   Shigella flexneri strain STEFF_24
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055169 (6135..6194 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_STEFF_24|unnamed2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTGGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4955 GenBank   NZ_CP055169
Plasmid name   STEFF_24|unnamed2 Incompatibility group   ColRNAI
Plasmid size   6817 bp Coordinate of oriT [Strand]   6135..6194 [+]
Host baterium   Shigella flexneri strain STEFF_24

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -