Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104514 |
| Name | oriT_STEFF_3|unnamed10  |
| Organism | Shigella flexneri strain STEFF_3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055209 (1069..1155 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_STEFF_3|unnamed10
GGGGTGTCGGGGCGAAGCCCTGACCAGACGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGACGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4953 | GenBank | NZ_CP055209 |
| Plasmid name | STEFF_3|unnamed10 | Incompatibility group | Col |
| Plasmid size | 1551 bp | Coordinate of oriT [Strand] | 1069..1155 [+] |
| Host baterium | Shigella flexneri strain STEFF_3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |