Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104498
Name   oriT_SWHIN_116|unnamed11 in_silico
Organism   Shigella flexneri strain SWHIN_116
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055086 (1068..1167 [+], 100 nt)
oriT length   100 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_SWHIN_116|unnamed11
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4937 GenBank   NZ_CP055086
Plasmid name   SWHIN_116|unnamed11 Incompatibility group   Col
Plasmid size   1549 bp Coordinate of oriT [Strand]   1068..1167 [+]
Host baterium   Shigella flexneri strain SWHIN_116

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -