Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104481
Name   oriT_STIN_87|unnamed4 in_silico
Organism   Shigella flexneri strain STIN_87
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054996 (1744..1801 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_STIN_87|unnamed4
GGGTTTCGGGCCGCAGCCCTGAACCAGTCAAGTAGCTCGTGCGGAGTGTATACGGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4920 GenBank   NZ_CP054996
Plasmid name   STIN_87|unnamed4 Incompatibility group   Col440I
Plasmid size   4729 bp Coordinate of oriT [Strand]   1744..1801 [-]
Host baterium   Shigella flexneri strain STIN_87

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -