Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104480 |
| Name | oriT_STIN_87|unnamed3 |
| Organism | Shigella flexneri strain STIN_87 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP054995 (68303..68401 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_STIN_87|unnamed3
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4919 | GenBank | NZ_CP054995 |
| Plasmid name | STIN_87|unnamed3 | Incompatibility group | IncY |
| Plasmid size | 80448 bp | Coordinate of oriT [Strand] | 68303..68401 [+] |
| Host baterium | Shigella flexneri strain STIN_87 |
Cargo genes
| Drug resistance gene | dfrA12, aadA2, qacE, sul1, mph(A), sul3, ant(3'')-Ia, aph(3')-Ia, aph(6)-Id, aph(3'')-Ib, sul2, catA2, blaTEM-1B, aac(3)-IId, tet(A) |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |