Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104479
Name   oriT_STIN_87|unnamed2 in_silico
Organism   Shigella flexneri strain STIN_87
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054994 (71804..72155 [+], 352 nt)
oriT length   352 nt
IRs (inverted repeats)      192..198, 206..212  (TATAAAA..TTTTATA)
 197..202, 204..209  (AAAACA..TGTTTT)
 104..110, 118..124  (TTTAAAT..ATTTAAA)
 106..111, 113..118  (TAAATC..GATTTA)
 93..98, 106..111  (GATTTA..TAAATC)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 352 nt

>oriT_STIN_87|unnamed2
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTATCTTTAATATCATTGAGTTGTATTTGTGGATTTATATTGTTTAAATCAGATTTATTTAAAACAGCGGTGTAGGCGCGGCTATGGCACCGTGTCTGCACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTGTTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGTCAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCACTATGAATTCCAGTGTTTCGAAATTAACTTTATTTTATGTTTAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


T4SS


T4SS were predicted by using oriTfinder2.

Region 1: 71233..78576

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
HUZ57_RS24165 (HUZ57_23945) 66348..66764 + 417 Protein_81 DUF1281 domain-containing protein -
HUZ57_RS24170 (HUZ57_23950) 66775..67140 + 366 Protein_82 hypothetical protein -
HUZ57_RS24175 (HUZ57_23955) 67195..67629 + 435 WP_000845928 conjugation system SOS inhibitor PsiB -
HUZ57_RS24180 (HUZ57_23960) 67626..68345 + 720 WP_000116341 plasmid SOS inhibition protein A -
HUZ57_RS24185 68562..68714 + 153 Protein_85 DUF5431 family protein -
HUZ57_RS24190 (HUZ57_23965) 68659..68781 + 123 WP_223200913 Hok/Gef family protein -
HUZ57_RS24195 69247..69408 - 162 Protein_87 hypothetical protein -
HUZ57_RS24200 (HUZ57_23970) 69478..69684 + 207 WP_000547959 hypothetical protein -
HUZ57_RS24205 (HUZ57_23975) 69709..69996 + 288 WP_000107534 hypothetical protein -
HUZ57_RS24210 (HUZ57_23980) 70116..70937 + 822 WP_001234475 DUF932 domain-containing protein -
HUZ57_RS24215 (HUZ57_23985) 71233..71880 - 648 WP_000601040 transglycosylase SLT domain-containing protein virB1
HUZ57_RS24220 (HUZ57_23990) 72156..72539 + 384 WP_001151533 conjugal transfer relaxosome DNA-binding protein TraM -
HUZ57_RS24225 (HUZ57_23995) 72731..73378 + 648 WP_000332517 conjugal transfer transcriptional regulator TraJ -
HUZ57_RS24230 (HUZ57_24000) 73514..73729 + 216 WP_000086380 conjugal transfer relaxosome protein TraY -
HUZ57_RS24235 (HUZ57_24005) 73772..74134 + 363 WP_000340279 type IV conjugative transfer system pilin TraA -
HUZ57_RS24240 (HUZ57_24010) 74139..74450 + 312 WP_000012106 type IV conjugative transfer system protein TraL traL
HUZ57_RS24245 (HUZ57_24015) 74472..75038 + 567 WP_000399793 type IV conjugative transfer system protein TraE traE
HUZ57_RS24250 (HUZ57_24020) 75025..75753 + 729 WP_001230787 type-F conjugative transfer system secretin TraK traK
HUZ57_RS24255 (HUZ57_24025) 75753..77180 + 1428 WP_000146688 F-type conjugal transfer pilus assembly protein TraB traB
HUZ57_RS24260 (HUZ57_24030) 77170..77757 + 588 WP_000002772 conjugal transfer pilus-stabilizing protein TraP -
HUZ57_RS24265 (HUZ57_24035) 77744..78064 + 321 WP_001057283 conjugal transfer protein TrbD -
HUZ57_RS24270 (HUZ57_24040) 78061..78576 + 516 WP_000724020 type IV conjugative transfer system lipoprotein TraV traV
HUZ57_RS24275 (HUZ57_24045) 78711..78932 + 222 WP_001278689 conjugal transfer protein TraR -
HUZ57_RS24280 (HUZ57_24050) 79092..80551 + 1460 Protein_104 TraC family protein -
HUZ57_RS24285 (HUZ57_24055) 80547..80711 + 165 Protein_105 conjugal transfer protein TraU -
HUZ57_RS24290 (HUZ57_24060) 80708..81664 + 957 Protein_106 conjugal transfer pilus assembly protein TraU -
HUZ57_RS24295 (HUZ57_24065) 81669..82145 + 477 Protein_107 TraD N-terminal domain-containing protein -
HUZ57_RS25085 82144..82611 + 468 Protein_108 hypothetical protein -
HUZ57_RS24305 (HUZ57_24075) 82928..83080 - 153 Protein_109 IS3 family transposase -


Host bacterium


ID   4918 GenBank   NZ_CP054994
Plasmid name   STIN_87|unnamed2 Incompatibility group   IncFII
Plasmid size   84141 bp Coordinate of oriT [Strand]   71804..72155 [+]
Host baterium   Shigella flexneri strain STIN_87

Cargo genes


Drug resistance gene   -
Virulence gene   faeC, faeD, faeE, faeF, faeG, faeH, faeI, faeJ
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -