Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104470
Name   oriT_SWHEFF_59|unnamed3 in_silico
Organism   Shigella flexneri strain SWHEFF_59
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055044 (778..834 [-], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT_SWHEFF_59|unnamed3
GGGTTTCGGGGGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACAGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4909 GenBank   NZ_CP055044
Plasmid name   SWHEFF_59|unnamed3 Incompatibility group   ColRNAI
Plasmid size   4981 bp Coordinate of oriT [Strand]   778..834 [-]
Host baterium   Shigella flexneri strain SWHEFF_59

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -