Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104443 |
| Name | oriT_STLEFF_44|unnamed3  |
| Organism | Klebsiella pneumoniae strain STLEFF_44 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058872 (78701..78750 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_STLEFF_44|unnamed3
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 55109..79308
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HZT31_RS27970 (HZT31_27905) | 50343..52625 | - | 2283 | Protein_51 | type IV conjugative transfer system coupling protein TraD | - |
| HZT31_RS27975 (HZT31_27910) | 52752..53441 | - | 690 | WP_240725934 | hypothetical protein | - |
| HZT31_RS27980 (HZT31_27915) | 53633..54364 | - | 732 | WP_004152622 | conjugal transfer complement resistance protein TraT | - |
| HZT31_RS27985 (HZT31_27920) | 54548..55096 | - | 549 | WP_004152623 | conjugal transfer entry exclusion protein TraS | - |
| HZT31_RS27990 (HZT31_27925) | 55109..57958 | - | 2850 | WP_004152624 | conjugal transfer mating-pair stabilization protein TraG | traG |
| HZT31_RS27995 (HZT31_27930) | 57958..59337 | - | 1380 | WP_011977731 | conjugal transfer pilus assembly protein TraH | traH |
| HZT31_RS28000 (HZT31_27935) | 59315..59758 | - | 444 | WP_004152679 | F-type conjugal transfer protein TrbF | - |
| HZT31_RS28005 (HZT31_27940) | 59804..60361 | - | 558 | WP_013214031 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| HZT31_RS28010 (HZT31_27945) | 60333..60572 | - | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| HZT31_RS28015 (HZT31_27950) | 60583..61335 | - | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| HZT31_RS28020 (HZT31_27955) | 61356..61682 | - | 327 | WP_013214030 | hypothetical protein | - |
| HZT31_RS28025 (HZT31_27960) | 61695..61943 | - | 249 | WP_004152675 | hypothetical protein | - |
| HZT31_RS28030 (HZT31_27965) | 61921..62175 | - | 255 | WP_073558194 | conjugal transfer protein TrbE | - |
| HZT31_RS28035 (HZT31_27970) | 62207..64162 | - | 1956 | WP_117061680 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| HZT31_RS28040 (HZT31_27975) | 64221..64859 | - | 639 | WP_150073634 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| HZT31_RS28045 (HZT31_27980) | 64872..65861 | - | 990 | WP_009309872 | conjugal transfer pilus assembly protein TraU | traU |
| HZT31_RS28050 (HZT31_27985) | 65858..66247 | - | 390 | WP_004152508 | hypothetical protein | - |
| HZT31_RS28055 (HZT31_27990) | 66289..66915 | - | 627 | WP_004152507 | type-F conjugative transfer system protein TraW | traW |
| HZT31_RS28060 (HZT31_27995) | 66915..67304 | - | 390 | WP_004152506 | type-F conjugative transfer system protein TrbI | - |
| HZT31_RS28065 (HZT31_28000) | 67304..69943 | - | 2640 | WP_004152505 | type IV secretion system protein TraC | virb4 |
| HZT31_RS28070 (HZT31_28005) | 70015..70413 | - | 399 | WP_011977783 | hypothetical protein | - |
| HZT31_RS28075 (HZT31_28010) | 70421..70810 | - | 390 | WP_004153076 | hypothetical protein | - |
| HZT31_RS28080 (HZT31_28015) | 70853..71257 | - | 405 | WP_004152503 | hypothetical protein | - |
| HZT31_RS28085 (HZT31_28020) | 71324..71635 | - | 312 | WP_004152502 | hypothetical protein | - |
| HZT31_RS28090 (HZT31_28025) | 71636..71854 | - | 219 | WP_004152501 | hypothetical protein | - |
| HZT31_RS28095 (HZT31_28030) | 71960..72370 | - | 411 | WP_004152499 | hypothetical protein | - |
| HZT31_RS28100 (HZT31_28035) | 72502..73086 | - | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| HZT31_RS28105 (HZT31_28040) | 73200..74624 | - | 1425 | WP_022644937 | F-type conjugal transfer pilus assembly protein TraB | traB |
| HZT31_RS28110 (HZT31_28045) | 74624..75364 | - | 741 | WP_117087731 | type-F conjugative transfer system secretin TraK | traK |
| HZT31_RS28115 (HZT31_28050) | 75351..75917 | - | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| HZT31_RS28120 (HZT31_28055) | 75937..76242 | - | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| HZT31_RS28125 (HZT31_28060) | 76256..76624 | - | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| HZT31_RS28130 (HZT31_28065) | 76678..77064 | - | 387 | WP_004152495 | TraY domain-containing protein | - |
| HZT31_RS28135 (HZT31_28070) | 77143..77829 | - | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| HZT31_RS28140 (HZT31_28075) | 78003..78401 | - | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| HZT31_RS28145 (HZT31_28080) | 78823..79308 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| HZT31_RS28150 (HZT31_28085) | 79341..79670 | - | 330 | WP_015065524 | DUF5983 family protein | - |
| HZT31_RS28155 (HZT31_28090) | 79703..80524 | - | 822 | WP_032441618 | DUF932 domain-containing protein | - |
| HZT31_RS28160 (HZT31_28095) | 81344..82177 | - | 834 | WP_004152751 | N-6 DNA methylase | - |
| HZT31_RS28165 (HZT31_28100) | 82228..82374 | - | 147 | WP_004152750 | hypothetical protein | - |
| HZT31_RS28170 (HZT31_28105) | 82469..82816 | - | 348 | WP_004152749 | hypothetical protein | - |
| HZT31_RS28175 (HZT31_28110) | 82873..83226 | - | 354 | WP_004152748 | hypothetical protein | - |
| HZT31_RS28180 (HZT31_28115) | 83856..84206 | - | 351 | WP_004153414 | hypothetical protein | - |
Host bacterium
| ID | 4882 | GenBank | NZ_CP058872 |
| Plasmid name | STLEFF_44|unnamed3 | Incompatibility group | IncFII |
| Plasmid size | 103039 bp | Coordinate of oriT [Strand] | 78701..78750 [+] |
| Host baterium | Klebsiella pneumoniae strain STLEFF_44 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |