Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104442 |
| Name | oriT_STLEFF_44|unnamed2  |
| Organism | Klebsiella pneumoniae strain STLEFF_44 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058871 (8146..8240 [+], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_STLEFF_44|unnamed2
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4881 | GenBank | NZ_CP058871 |
| Plasmid name | STLEFF_44|unnamed2 | Incompatibility group | IncFIA |
| Plasmid size | 115053 bp | Coordinate of oriT [Strand] | 8146..8240 [+] |
| Host baterium | Klebsiella pneumoniae strain STLEFF_44 |
Cargo genes
| Drug resistance gene | sul1, blaCTX-M-15, blaTEM-1B, aadA2, cmlA1, ant(3'')-Ia, sul3, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(3'')-Ib, aph(6)-Id, floR, catA2, tet(D), aac(6')-Ib-cr, ARR-3, dfrA27, aadA16, qacE, qnrB52 |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |