Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104428
Name   oriT_pRHBSTW-00056_3 in_silico
Organism   Enterobacter hormaechei strain RHBSTW-00056
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058174 (249..308 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-00056_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4867 GenBank   NZ_CP058174
Plasmid name   pRHBSTW-00056_3 Incompatibility group   Col440II
Plasmid size   4426 bp Coordinate of oriT [Strand]   249..308 [-]
Host baterium   Enterobacter hormaechei strain RHBSTW-00056

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -