Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104420
Name   oriT_pRHBSTW-00916_2 in_silico
Organism   Enterobacter hormaechei strain RHBSTW-00916
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056133 (66409..66507 [+], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 26..31, 40..45  (GTGATA..TATCAC)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pRHBSTW-00916_2
TTTGTTTTTTTCCTTTTAAATCAGTGTGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4859 GenBank   NZ_CP056133
Plasmid name   pRHBSTW-00916_2 Incompatibility group   IncFIB
Plasmid size   76485 bp Coordinate of oriT [Strand]   66409..66507 [+]
Host baterium   Enterobacter hormaechei strain RHBSTW-00916

Cargo genes


Drug resistance gene   -
Virulence gene   mrkA, mrkB, mrkC, mrkD, mrkF, mrkJ
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -