Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104411 |
| Name | oriT_RHBSTW-00405|unnamed  |
| Organism | Klebsiella pneumoniae strain RHBSTW-00405 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055525 (45..92 [-], 48 nt) |
| oriT length | 48 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | 31..32 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 48 nt
>oriT_RHBSTW-00405|unnamed
ATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4850 | GenBank | NZ_CP055525 |
| Plasmid name | RHBSTW-00405|unnamed | Incompatibility group | - |
| Plasmid size | 3627 bp | Coordinate of oriT [Strand] | 45..92 [-] |
| Host baterium | Klebsiella pneumoniae strain RHBSTW-00405 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |