Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104404
Name   oriT_pRHBSTW-00574_5 in_silico
Organism   Klebsiella pneumoniae strain RHBSTW-00574
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055455 (2880..2931 [+], 52 nt)
oriT length   52 nt
IRs (inverted repeats)      6..14, 17..25  (CGCAAAATT..AATTTTGCG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 52 nt

>oriT_pRHBSTW-00574_5
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4843 GenBank   NZ_CP055455
Plasmid name   pRHBSTW-00574_5 Incompatibility group   ColRNAI
Plasmid size   3322 bp Coordinate of oriT [Strand]   2880..2931 [+]
Host baterium   Klebsiella pneumoniae strain RHBSTW-00574

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -