Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104388 |
| Name | oriT_pRHB38-C01_4 |
| Organism | Escherichia fergusonii strain RHB38-C01 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP057107 (4282..4341 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRHB38-C01_4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4827 | GenBank | NZ_CP057107 |
| Plasmid name | pRHB38-C01_4 | Incompatibility group | Col440I |
| Plasmid size | 5603 bp | Coordinate of oriT [Strand] | 4282..4341 [+] |
| Host baterium | Escherichia fergusonii strain RHB38-C01 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |