Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104367 |
| Name | oriT_pShVSI35_3  |
| Organism | Staphylococcus haemolyticus strain VSI35 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP118063 (3990..4109 [+], 120 nt) |
| oriT length | 120 nt |
| IRs (inverted repeats) | 53..60, 62..69 (TTGGGGAT..ATCCCCAA) 24..31, 35..42 (ATTTTTTC..GAAAAAAT) 1..8, 15..22 (AGTGGCTA..TAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 120 nt
>oriT_pShVSI35_3
AGTGGCTATCTTTTTAGCCACTTATTTTTTCTACGAAAAAATCCTAGGGGGTTTGGGGATTATCCCCAACAAGCAGGCGACGATACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAA
AGTGGCTATCTTTTTAGCCACTTATTTTTTCTACGAAAAAATCCTAGGGGGTTTGGGGATTATCCCCAACAAGCAGGCGACGATACCACGTGAGTGGCTAGCAAAGCCAATGCTTGCCAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4806 | GenBank | NZ_CP118063 |
| Plasmid name | pShVSI35_3 | Incompatibility group | - |
| Plasmid size | 4316 bp | Coordinate of oriT [Strand] | 3990..4109 [+] |
| Host baterium | Staphylococcus haemolyticus strain VSI35 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |