Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104363 |
| Name | oriT1_pSa_VSI52  |
| Organism | Streptococcus anginosus strain VSI52 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP118047 ( 1116..1170 [-], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 1..7, 9..15 (GTTGATA..TATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT1_pSa_VSI52
GTTGATACTATCAACTTCCCACGGAATGTGGGGACAATTTCCCTTATGCTCTTTT
GTTGATACTATCAACTTCCCACGGAATGTGGGGACAATTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4802 | GenBank | NZ_CP118047 |
| Plasmid name | pSa_VSI52 | Incompatibility group | - |
| Plasmid size | 15660 bp | Coordinate of oriT [Strand] | 4740..4794 [+]; 1116..1170 [-] |
| Host baterium | Streptococcus anginosus strain VSI52 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |