Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104359
Name   oriT_pK432-TEM in_silico
Organism   Enterobacter hormaechei strain K432
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OP821751 (11945..12043 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pK432-TEM
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4798 GenBank   NZ_OP821751
Plasmid name   pK432-TEM Incompatibility group   IncR
Plasmid size   75630 bp Coordinate of oriT [Strand]   11945..12043 [-]
Host baterium   Enterobacter hormaechei strain K432

Cargo genes


Drug resistance gene   blaSFO-1, blaTEM-1B
Virulence gene   rffG, gmd, fcl, manC
Metal resistance gene   merE, merD, merA, merP, merT, merR, arsR, arsD
Degradation gene   -
Symbiosis gene   noeL
Anti-CRISPR   -