Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104359 |
| Name | oriT_pK432-TEM  |
| Organism | Enterobacter hormaechei strain K432 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OP821751 (11945..12043 [-], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pK432-TEM
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4798 | GenBank | NZ_OP821751 |
| Plasmid name | pK432-TEM | Incompatibility group | IncR |
| Plasmid size | 75630 bp | Coordinate of oriT [Strand] | 11945..12043 [-] |
| Host baterium | Enterobacter hormaechei strain K432 |
Cargo genes
| Drug resistance gene | blaSFO-1, blaTEM-1B |
| Virulence gene | rffG, gmd, fcl, manC |
| Metal resistance gene | merE, merD, merA, merP, merT, merR, arsR, arsD |
| Degradation gene | - |
| Symbiosis gene | noeL |
| Anti-CRISPR | - |