Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104355 |
| Name | oriT1_2020CK-00199|unnamed4  |
| Organism | Enterobacter hormaechei strain 2020CK-00199 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP118571 (280..336 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT1_2020CK-00199|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4794 | GenBank | NZ_CP118571 |
| Plasmid name | 2020CK-00199|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 5194 bp | Coordinate of oriT [Strand] | 280..336 [-]; 2977..3035 [-] |
| Host baterium | Enterobacter hormaechei strain 2020CK-00199 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |