Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104355
Name   oriT1_2020CK-00199|unnamed4 in_silico
Organism   Enterobacter hormaechei strain 2020CK-00199
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP118571 (280..336 [-], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT1_2020CK-00199|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4794 GenBank   NZ_CP118571
Plasmid name   2020CK-00199|unnamed4 Incompatibility group   Col440I
Plasmid size   5194 bp Coordinate of oriT [Strand]   280..336 [-]; 2977..3035 [-]
Host baterium   Enterobacter hormaechei strain 2020CK-00199

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -