Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104344
Name   oriT_2020CK-00223|unnamed6 in_silico
Organism   Klebsiella pneumoniae strain 2020CK-00223
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP118404 (1133..1188 [-], 56 nt)
oriT length   56 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 56 nt

>oriT_2020CK-00223|unnamed6
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4783 GenBank   NZ_CP118404
Plasmid name   2020CK-00223|unnamed6 Incompatibility group   -
Plasmid size   1240 bp Coordinate of oriT [Strand]   1133..1188 [-]
Host baterium   Klebsiella pneumoniae strain 2020CK-00223

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -