Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104320
Name   oriT1_pWSI1 in_silico
Organism   Staphylococcus aureus strain SI1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LC383633 (1284..1523 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_pWSI1
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4759 GenBank   NZ_LC383633
Plasmid name   pWSI1 Incompatibility group   -
Plasmid size   32573 bp Coordinate of oriT [Strand]   1284..1523 [+]; 20646..20880 [-]
Host baterium   Staphylococcus aureus strain SI1

Cargo genes


Drug resistance gene   qacB
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21