Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104320 |
Name | oriT1_pWSI1 |
Organism | Staphylococcus aureus strain SI1 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LC383633 (1284..1523 [+], 240 nt) |
oriT length | 240 nt |
IRs (inverted repeats) | 217..222, 232..237 (ATTTTA..TAAAAT) 171..178, 183..190 (CTATCATT..AATGATAG) 154..160, 164..170 (GTCTGGC..GCCAGAC) 37..42, 45..50 (TTTTTT..AAAAAA) 36..41, 45..50 (TTTTTT..AAAAAA) 1..7, 20..26 (AAGACAT..ATGTCTT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 240 nt
>oriT1_pWSI1
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4759 | GenBank | NZ_LC383633 |
Plasmid name | pWSI1 | Incompatibility group | - |
Plasmid size | 32573 bp | Coordinate of oriT [Strand] | 1284..1523 [+]; 20646..20880 [-] |
Host baterium | Staphylococcus aureus strain SI1 |
Cargo genes
Drug resistance gene | qacB |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIIA21 |