Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104315 |
| Name | oriT_XY05-03|unnamed3  |
| Organism | Klebsiella pneumoniae strain XY05-03 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP116494 (68999..69048 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_XY05-03|unnamed3
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4754 | GenBank | NZ_CP116494 |
| Plasmid name | XY05-03|unnamed3 | Incompatibility group | IncR |
| Plasmid size | 85083 bp | Coordinate of oriT [Strand] | 68999..69048 [-] |
| Host baterium | Klebsiella pneumoniae strain XY05-03 |
Cargo genes
| Drug resistance gene | blaSHV-12, blaKPC-2, blaCTX-M-65 |
| Virulence gene | - |
| Metal resistance gene | merE, merD, merA, merP, merT, merR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |