Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104314 |
| Name | oriT_XY05-03|unnamed1  |
| Organism | Klebsiella pneumoniae strain XY05-03 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP116492 (37602..37629 [+], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_XY05-03|unnamed1
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4753 | GenBank | NZ_CP116492 |
| Plasmid name | XY05-03|unnamed1 | Incompatibility group | IncHI1B |
| Plasmid size | 218592 bp | Coordinate of oriT [Strand] | 37602..37629 [+] |
| Host baterium | Klebsiella pneumoniae strain XY05-03 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iutA, iucC, iucB, iucA, rmpA |
| Metal resistance gene | pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE, terE, terD, terC, terB, terA, terZ, terW, pbrA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |