Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104303 |
| Name | oriT_p12795_2  |
| Organism | Enterobacter roggenkampii strain 12795-yvys |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP083855 (5395..5494 [+], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | 78..83, 90..95 (AAAAAA..TTTTTT) 78..83, 89..94 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 18..24, 36..42 (TAAATCA..TGATTTA) |
| Location of nic site | 60..61 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_p12795_2
ATTTGGTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
ATTTGGTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4742 | GenBank | NZ_CP083855 |
| Plasmid name | p12795_2 | Incompatibility group | IncFIA |
| Plasmid size | 64408 bp | Coordinate of oriT [Strand] | 5395..5494 [+] |
| Host baterium | Enterobacter roggenkampii strain 12795-yvys |
Cargo genes
| Drug resistance gene | floR, catA2, sul1, qacE, qnrB6, aadA16, dfrA27, ARR-3, aac(6')-Ib-cr |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |