Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104300 |
| Name | oriT_p12961_1 |
| Organism | Enterobacter cloacae subsp. cloacae strain 12961-yvys |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP083822 (49658..49752 [+], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_p12961_1
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4739 | GenBank | NZ_CP083822 |
| Plasmid name | p12961_1 | Incompatibility group | IncFIA |
| Plasmid size | 90256 bp | Coordinate of oriT [Strand] | 49658..49752 [+] |
| Host baterium | Enterobacter cloacae subsp. cloacae strain 12961-yvys |
Cargo genes
| Drug resistance gene | tet(D), catA2, aac(3)-IId, blaTEM-1B, blaLAP-2, qnrS1, aph(6)-Id, aph(3'')-Ib, sul2, dfrA14, mcr-10 |
| Virulence gene | mrkA, mrkB, mrkC, mrkD, mrkF |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |