Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104245
Name   oriT_pQGU13 in_silico
Organism   Enterobacter cloacae strain WW13 IncQ1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MH718731 (246..405 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pQGU13
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4684 GenBank   NZ_MH718731
Plasmid name   pQGU13 Incompatibility group   IncQ1
Plasmid size   15473 bp Coordinate of oriT [Strand]   246..405 [-]
Host baterium   Enterobacter cloacae strain WW13 IncQ1

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, blaOXA-10
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -