Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104243
Name   oriT_pOfk55 in_silico
Organism   Legionella pneumophila strain Ofk308
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LC215275 (1643..1675 [-], 33 nt)
oriT length   33 nt
IRs (inverted repeats)      3..9, 13..19  (ACGTTGC..GCAACGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 33 nt

>oriT_pOfk55
GCACGTTGCCATGCAACGTATAAGCGCGCACTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4682 GenBank   NZ_LC215275
Plasmid name   pOfk55 Incompatibility group   -
Plasmid size   2584 bp Coordinate of oriT [Strand]   1643..1675 [-]
Host baterium   Legionella pneumophila strain Ofk308

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -