Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104243 |
| Name | oriT_pOfk55  |
| Organism | Legionella pneumophila strain Ofk308 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LC215275 (1643..1675 [-], 33 nt) |
| oriT length | 33 nt |
| IRs (inverted repeats) | 3..9, 13..19 (ACGTTGC..GCAACGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 33 nt
>oriT_pOfk55
GCACGTTGCCATGCAACGTATAAGCGCGCACTT
GCACGTTGCCATGCAACGTATAAGCGCGCACTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4682 | GenBank | NZ_LC215275 |
| Plasmid name | pOfk55 | Incompatibility group | - |
| Plasmid size | 2584 bp | Coordinate of oriT [Strand] | 1643..1675 [-] |
| Host baterium | Legionella pneumophila strain Ofk308 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |