Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104209 |
| Name | oriT_SCPM-O-B-5935 (I-1996)|pPCP  |
| Organism | Yersinia pestis strain SCPM-O-B-5935 (I-1996) |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP045157 (5705..5764 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_SCPM-O-B-5935 (I-1996)|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4648 | GenBank | NZ_CP045157 |
| Plasmid name | SCPM-O-B-5935 (I-1996)|pPCP | Incompatibility group | ColRNAI |
| Plasmid size | 9611 bp | Coordinate of oriT [Strand] | 5705..5764 [+] |
| Host baterium | Yersinia pestis strain SCPM-O-B-5935 (I-1996) |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | pla |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |