Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 104201
• Name: oriT1_pMT-pPCP
• Organism: Yersinia pestis Angola
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_010158 ( 12814..12873 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT1_pMT-pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 4640
• GenBank: NC_010158
• Plasmid name: pMT-pPCP
• Incompatibility group: ColRNAI
• Plasmid size: 114570 bp
• Coordinate of oriT [Strand]: 3206..3265 [+]; 12814..12873 [+]
• Host baterium: Yersinia pestis Angola

Cargo genes

• Drug resistance gene: -
• Virulence gene: pla, ymt
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -