Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 104199
• Name: oriT_Nepal516|pPCP
• Organism: Yersinia pestis Nepal516
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_008119 (4367..4426 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_Nepal516|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 4638
• GenBank: NC_008119
• Plasmid name: Nepal516|pPCP
• Incompatibility group: ColRNAI
• Plasmid size: 10778 bp
• Coordinate of oriT [Strand]: 4367..4426 [+]
• Host baterium: Yersinia pestis Nepal516

Cargo genes

• Drug resistance gene: -
• Virulence gene: pla
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -