Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104199
Name   oriT_Nepal516|pPCP in_silico
Organism   Yersinia pestis Nepal516
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_008119 (4367..4426 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_Nepal516|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4638 GenBank   NC_008119
Plasmid name   Nepal516|pPCP Incompatibility group   ColRNAI
Plasmid size   10778 bp Coordinate of oriT [Strand]   4367..4426 [+]
Host baterium   Yersinia pestis Nepal516

Cargo genes


Drug resistance gene   -
Virulence gene   pla
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -