Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104189 |
| Name | oriT_pLMST6  |
| Organism | Listeria monocytogenes strain 11-04869 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP110923 (2956..2994 [+], 39 nt) |
| oriT length | 39 nt |
| IRs (inverted repeats) | 1..6, 11..16 (CTTTAC..GTAAAG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 39 nt
>oriT_pLMST6
CTTTACGCATGTAAAGTATAATGTGTTATACTTTACATG
CTTTACGCATGTAAAGTATAATGTGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4628 | GenBank | NZ_CP110923 |
| Plasmid name | pLMST6 | Incompatibility group | - |
| Plasmid size | 4265 bp | Coordinate of oriT [Strand] | 2956..2994 [+] |
| Host baterium | Listeria monocytogenes strain 11-04869 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |