Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104189 |
Name | oriT_pLMST6 |
Organism | Listeria monocytogenes strain 11-04869 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP110923 (2956..2994 [+], 39 nt) |
oriT length | 39 nt |
IRs (inverted repeats) | 1..6, 11..16 (CTTTAC..GTAAAG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 39 nt
>oriT_pLMST6
CTTTACGCATGTAAAGTATAATGTGTTATACTTTACATG
CTTTACGCATGTAAAGTATAATGTGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4628 | GenBank | NZ_CP110923 |
Plasmid name | pLMST6 | Incompatibility group | - |
Plasmid size | 4265 bp | Coordinate of oriT [Strand] | 2956..2994 [+] |
Host baterium | Listeria monocytogenes strain 11-04869 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |