Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104162 |
| Name | oriT_pKLO00002_2  |
| Organism | Klebsiella grimontii strain KLO00002 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OP378634 (109506..109554 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pKLO00002_2
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 85940..107128
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PWC41_RS00830 | 81135..81548 | - | 414 | WP_227634853 | hypothetical protein | - |
| PWC41_RS00835 | 81607..81780 | - | 174 | WP_337993041 | hypothetical protein | - |
| PWC41_RS00840 | 81701..82417 | - | 717 | Protein_105 | type IV secretion system DNA-binding domain-containing protein | - |
| PWC41_RS00845 | 82411..83442 | - | 1032 | WP_337993038 | type IV secretion system DNA-binding domain-containing protein | - |
| PWC41_RS00535 | 83571..84260 | - | 690 | WP_196565414 | hypothetical protein | - |
| PWC41_RS00540 | 84452..85183 | - | 732 | WP_032329926 | conjugal transfer complement resistance protein TraT | - |
| PWC41_RS00545 | 85700..85918 | + | 219 | WP_274066320 | hypothetical protein | - |
| PWC41_RS00550 | 85940..88783 | - | 2844 | WP_196565415 | conjugal transfer mating-pair stabilization protein TraG | traG |
| PWC41_RS00555 | 88783..90160 | - | 1378 | Protein_111 | conjugal transfer pilus assembly protein TraH | - |
| PWC41_RS00560 | 90138..90581 | - | 444 | WP_032441890 | F-type conjugal transfer protein TrbF | - |
| PWC41_RS00565 | 90627..91184 | - | 558 | WP_196565416 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| PWC41_RS00570 | 91156..91395 | - | 240 | WP_023316407 | type-F conjugative transfer system pilin chaperone TraQ | - |
| PWC41_RS00575 | 91406..92158 | - | 753 | WP_049119076 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| PWC41_RS00580 | 92179..92505 | - | 327 | WP_064144773 | hypothetical protein | - |
| PWC41_RS00585 | 92516..92741 | - | 226 | Protein_117 | conjugal transfer protein TrbE | - |
| PWC41_RS00590 | 93047..94999 | - | 1953 | WP_196565417 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| PWC41_RS00595 | 94996..95379 | - | 384 | WP_196565418 | hypothetical protein | - |
| PWC41_RS00600 | 95376..96014 | - | 639 | WP_064169679 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| PWC41_RS00605 | 96027..96986 | - | 960 | WP_168712236 | conjugal transfer pilus assembly protein TraU | traU |
| PWC41_RS00610 | 97030..97656 | - | 627 | WP_064169680 | type-F conjugative transfer system protein TraW | traW |
| PWC41_RS00615 | 97656..98045 | - | 390 | WP_020326931 | type-F conjugative transfer system protein TrbI | - |
| PWC41_RS00620 | 98045..100684 | - | 2640 | WP_049155532 | type IV secretion system protein TraC | virb4 |
| PWC41_RS00625 | 100756..101154 | - | 399 | WP_072158599 | hypothetical protein | - |
| PWC41_RS00630 | 101162..101452 | - | 291 | WP_196565419 | hypothetical protein | - |
| PWC41_RS00635 | 101449..101853 | - | 405 | WP_023292152 | hypothetical protein | - |
| PWC41_RS00640 | 101898..102236 | - | 339 | WP_196565420 | hypothetical protein | - |
| PWC41_RS00645 | 102237..102455 | - | 219 | WP_004171484 | hypothetical protein | - |
| PWC41_RS00650 | 102479..102769 | - | 291 | WP_064144762 | hypothetical protein | - |
| PWC41_RS00655 | 102774..103184 | - | 411 | WP_064144761 | hypothetical protein | - |
| PWC41_RS00660 | 103316..103885 | - | 570 | WP_114501461 | type IV conjugative transfer system lipoprotein TraV | traV |
| PWC41_RS00665 | 104086..105510 | - | 1425 | WP_196565421 | F-type conjugal transfer pilus assembly protein TraB | traB |
| PWC41_RS00670 | 105510..106250 | - | 741 | WP_155005787 | type-F conjugative transfer system secretin TraK | traK |
| PWC41_RS00675 | 106237..106803 | - | 567 | WP_020316627 | type IV conjugative transfer system protein TraE | traE |
| PWC41_RS00680 | 106823..107128 | - | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| PWC41_RS00685 | 107142..107510 | - | 369 | WP_020316649 | type IV conjugative transfer system pilin TraA | - |
| PWC41_RS00690 | 107578..107778 | - | 201 | WP_048289787 | TraY domain-containing protein | - |
| PWC41_RS00695 | 107864..108565 | - | 702 | WP_224396655 | hypothetical protein | - |
| PWC41_RS00700 | 108804..109196 | - | 393 | WP_020805752 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| PWC41_RS00705 | 109699..110106 | + | 408 | WP_224396658 | transglycosylase SLT domain-containing protein | - |
| PWC41_RS00710 | 110144..110674 | - | 531 | WP_082226180 | antirestriction protein | - |
Host bacterium
| ID | 4601 | GenBank | NZ_OP378634 |
| Plasmid name | pKLO00002_2 | Incompatibility group | IncFIB |
| Plasmid size | 125202 bp | Coordinate of oriT [Strand] | 109506..109554 [+] |
| Host baterium | Klebsiella grimontii strain KLO00002 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | silE, silR, silC, silF, silB, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |