Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104158 |
| Name | oriT_pKLP00172_4  |
| Organism | Klebsiella pneumoniae strain KLP00172 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OP378656 (29833..29924 [+], 92 nt) |
| oriT length | 92 nt |
| IRs (inverted repeats) | 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 92 nt
>oriT_pKLP00172_4
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAATCATCTTTTTT
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAATCATCTTTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4597 | GenBank | NZ_OP378656 |
| Plasmid name | pKLP00172_4 | Incompatibility group | IncFIB |
| Plasmid size | 43132 bp | Coordinate of oriT [Strand] | 29833..29924 [+] |
| Host baterium | Klebsiella pneumoniae strain KLP00172 |
Cargo genes
| Drug resistance gene | aph(4)-Ia, aac(3)-IVa, sul3, ant(3'')-Ia, cmlA1, aadA2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |