Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104142
Name   oriT_pSER00066_3 in_silico
Organism   Serratia marcescens strain SER00066
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OP378669 (162..211 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      5..12, 15..22  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_pSER00066_3
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4581 GenBank   NZ_OP378669
Plasmid name   pSER00066_3 Incompatibility group   -
Plasmid size   4165 bp Coordinate of oriT [Strand]   162..211 [+]
Host baterium   Serratia marcescens strain SER00066

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -