Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104142 |
| Name | oriT_pSER00066_3  |
| Organism | Serratia marcescens strain SER00066 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OP378669 (162..211 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pSER00066_3
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4581 | GenBank | NZ_OP378669 |
| Plasmid name | pSER00066_3 | Incompatibility group | - |
| Plasmid size | 4165 bp | Coordinate of oriT [Strand] | 162..211 [+] |
| Host baterium | Serratia marcescens strain SER00066 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |