Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104127 |
| Name | oriT_L1|unnamed3  |
| Organism | Salmonella enterica subsp. enterica serovar London strain L1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117701 (1667..1726 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_L1|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4566 | GenBank | NZ_CP117701 |
| Plasmid name | L1|unnamed3 | Incompatibility group | Col440I |
| Plasmid size | 1888 bp | Coordinate of oriT [Strand] | 1667..1726 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar London strain L1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |