Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104123 |
Name | oriT_2022CK-00781|unnamed8 |
Organism | Klebsiella grimontii strain 2022CK-00781 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP117738 (2432..2491 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_2022CK-00781|unnamed8
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4562 | GenBank | NZ_CP117738 |
Plasmid name | 2022CK-00781|unnamed8 | Incompatibility group | Col440II |
Plasmid size | 6999 bp | Coordinate of oriT [Strand] | 2432..2491 [+] |
Host baterium | Klebsiella grimontii strain 2022CK-00781 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |