Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104117 |
| Name | oriT_2022CK-00768|unnamed4  |
| Organism | Klebsiella pneumoniae strain 2022CK-00768 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117744 (3436..3486 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_2022CK-00768|unnamed4
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4556 | GenBank | NZ_CP117744 |
| Plasmid name | 2022CK-00768|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 4167 bp | Coordinate of oriT [Strand] | 3436..3486 [+] |
| Host baterium | Klebsiella pneumoniae strain 2022CK-00768 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |