Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104116 |
Name | oriT_2022CK-00768|unnamed3 |
Organism | Klebsiella pneumoniae strain 2022CK-00768 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP117743 (19456..19554 [-], 99 nt) |
oriT length | 99 nt |
IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
Location of nic site | 59..60 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_2022CK-00768|unnamed3
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4555 | GenBank | NZ_CP117743 |
Plasmid name | 2022CK-00768|unnamed3 | Incompatibility group | IncR |
Plasmid size | 39711 bp | Coordinate of oriT [Strand] | 19456..19554 [-] |
Host baterium | Klebsiella pneumoniae strain 2022CK-00768 |
Cargo genes
Drug resistance gene | aac(6')-Ib, ant(3'')-Ia, blaOXA-9, blaTEM-1A |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |