Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104115
Name   oriT_DS-1|unnamed4 in_silico
Organism   Klebsiella pneumoniae strain DS-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117485 (1923..1973 [-], 51 nt)
oriT length   51 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_DS-1|unnamed4
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4554 GenBank   NZ_CP117485
Plasmid name   DS-1|unnamed4 Incompatibility group   ColRNAI
Plasmid size   2789 bp Coordinate of oriT [Strand]   1923..1973 [-]
Host baterium   Klebsiella pneumoniae strain DS-1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -