Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 104113 |
| Name | oriT_pEA22_8 |
| Organism | Escherichia albertii strain BIA_22 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP117636 (779..867 [-], 89 nt) |
| oriT length | 89 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 89 nt
>oriT_pEA22_8
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 4552 | GenBank | NZ_CP117636 |
| Plasmid name | pEA22_8 | Incompatibility group | Col |
| Plasmid size | 1590 bp | Coordinate of oriT [Strand] | 779..867 [-] |
| Host baterium | Escherichia albertii strain BIA_22 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |