Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104113
Name   oriT_pEA22_8 in_silico
Organism   Escherichia albertii strain BIA_22
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117636 (779..867 [-], 89 nt)
oriT length   89 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 89 nt

>oriT_pEA22_8
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4552 GenBank   NZ_CP117636
Plasmid name   pEA22_8 Incompatibility group   Col
Plasmid size   1590 bp Coordinate of oriT [Strand]   779..867 [-]
Host baterium   Escherichia albertii strain BIA_22

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -