Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104113 |
Name | oriT_pEA22_8 |
Organism | Escherichia albertii strain BIA_22 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP117636 (779..867 [-], 89 nt) |
oriT length | 89 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 89 nt
>oriT_pEA22_8
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT
GGGTGTCGGGGTGAAGCCCTGACCAGATAGGCAATTGTGATAGTGTCGCGGGTGACAGTATTACATTTGCACATCCTGTCCCGATTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4552 | GenBank | NZ_CP117636 |
Plasmid name | pEA22_8 | Incompatibility group | Col |
Plasmid size | 1590 bp | Coordinate of oriT [Strand] | 779..867 [-] |
Host baterium | Escherichia albertii strain BIA_22 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |