Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104107 |
Name | oriT_pEA32_5 |
Organism | Escherichia albertii strain BIA_32 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP117605 (2695..2978 [-], 284 nt) |
oriT length | 284 nt |
IRs (inverted repeats) | 245..250, 253..258 (CGCCCC..GGGGCG) 184..189, 197..202 (ATAAAA..TTTTAT) 130..138, 148..156 (GCGGTGTTG..CAACACCGC) 31..37, 42..48 (GCAAAAA..TTTTTGC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 284 nt
>oriT_pEA32_5
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4546 | GenBank | NZ_CP117605 |
Plasmid name | pEA32_5 | Incompatibility group | ColRNAI |
Plasmid size | 3758 bp | Coordinate of oriT [Strand] | 2695..2978 [-] |
Host baterium | Escherichia albertii strain BIA_32 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |