Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 104099 |
Name | oriT_pEA7_5 |
Organism | Escherichia albertii strain BIA_7 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP117567 (1474..1756 [+], 283 nt) |
oriT length | 283 nt |
IRs (inverted repeats) | 244..249, 252..257 (CGCCCC..GGGGCG) 183..188, 196..201 (ATAAAA..TTTTAT) 129..137, 147..155 (GCGGTGTTG..CAACACCGC) 30..36, 41..47 (GCAAAAA..TTTTTGC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 283 nt
>oriT_pEA7_5
GTTCTCATGCCTGAAATGCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG
GTTCTCATGCCTGAAATGCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 4538 | GenBank | NZ_CP117567 |
Plasmid name | pEA7_5 | Incompatibility group | - |
Plasmid size | 2283 bp | Coordinate of oriT [Strand] | 1474..1756 [+] |
Host baterium | Escherichia albertii strain BIA_7 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |