Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   104099
Name   oriT_pEA7_5 in_silico
Organism   Escherichia albertii strain BIA_7
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP117567 (1474..1756 [+], 283 nt)
oriT length   283 nt
IRs (inverted repeats)      244..249, 252..257  (CGCCCC..GGGGCG)
 183..188, 196..201  (ATAAAA..TTTTAT)
 129..137, 147..155  (GCGGTGTTG..CAACACCGC)
 30..36, 41..47  (GCAAAAA..TTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 283 nt

>oriT_pEA7_5
GTTCTCATGCCTGAAATGCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   4538 GenBank   NZ_CP117567
Plasmid name   pEA7_5 Incompatibility group   -
Plasmid size   2283 bp Coordinate of oriT [Strand]   1474..1756 [+]
Host baterium   Escherichia albertii strain BIA_7

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -